Skip to content

Advertisement

  • Research Article
  • Open Access

Identification of tick-borne pathogen diversity by metagenomic analysis in Haemaphysalis longicornis from Xinyang, China

Contributed equally
Infectious Diseases of Poverty20187:45

https://doi.org/10.1186/s40249-018-0417-4

  • Received: 3 August 2017
  • Accepted: 5 April 2018
  • Published:

Abstract

Background

A wide variety of pathogens could be maintained and transmitted by Haemaphysalis longicornis. The aim of this study is to systematically examine the variety of pathogens carried by Haemaphysalis longicornis, an importnatn vector, in tick-borne diseases epidemic area, and to estimate the risk of human infection imposed by tick bites.

Methods

Adult questing ticks were collected in Xinyang, central China. Genomic DNA and RNA were extracted from 144 H. longicornis ticks individually, and sequenced respectively as the templates for high-throughput sequencing. Clean reads were compared against the database of NCBI nucleotide collection and specific PCR was performed to confirm the presence of pathogen. Phylogenetic analysis was performed to explore the evolutionary status of pathogens.

Results

The assignment of reads to taxa based on BLASTN results revealed the existence of several potential pathogens, including Anaplasma spp., Rickettsia spp., Babesia sp., as well as severe fever with thrombocytopenia syndrome bunyavirus (SFTSV). Comfirmantory PCR assays revealed the existence of Anaplasma bovis (13/144, 9.03%), Anaplasma centrale (2/144, 1.39%), Rickettsia heilongjiangensis (3/144, 2.08%), Rickettsia sp. LON-13 (1/144, 0.69%), Rickettsia raoultii (5/144, 3.47%), Babesia sp. (1/144, 0.69%). SFTSV accounted for the highest detected pathogen with a positive rate of 18.75% (27/144). Three of the ticks (2.08%) were co-infected with SFTSV and A. bovis.

Conclusion

Our study provided a broadened list of microorganism that harbored by H. longicornis. In previously unrecognized endemic regions, prokaryotic and eukaryotic infection including Anaplasma spp., Rickettsiae spp., and Babesia spp. should be considered, along with the well-known SFTSV for patients with tick bites history. A novel Babesia species was identified in local natural foci, which needs further investigation in the future.

Keywords

  • Haemaphysalis longicornis
  • Pathogens
  • High-throughput sequencing

Multilingual abstracts

Please see Additional file 1 for translations of the abstract into the five official working languages of the United Nations.

Background

Haemaphysalis longicornis is one of the most important tick species that imposes the risks of tick-bonre disease infection, which is widely distributed in the Asia-Pacific region, including Korea, Japan, Australia, the Pacific Islands, and New Zealand [15]. Common hosts of H. longicornis include goats, cattle, sheep, Bos mutus, donkeys, pigs, Cervus elaphus, cats, Rattus norregicus, Mus culus, Erinaceus europaeus, Mustela sibirica, Trichosurus vulpecula, and some birds, along with human beings, which is commonly considered as the definitive host [57]. A wide variety of pathogens can be maintained and transmitted by H.longicornis. A remarkable example is the novel phlebovirus in the Bunyaviridae family (severe fever with thrombocytopenia syndrome virus, SFTSV), which was newly identified to be a causal agent of severe fever with thrombocytopenia syndrome (SFTS) in China and other neighbouring countries [810]. SFTS is largely considered to be a tick-associated disease, as high proportion of patients had tick exposure before disease onset [8]. H. longicornis, the most prevelant tick species that infests human in SFTS-endemic areas, was determined to be a competent vector of SFTSV by an experimental maintenance and transmission study [11]. In this context, we performed a metagenomic analysis to provide an inventory of predicted and unexpected pathogenic agents carried by H. longicornis ticks, captured in Xinyang Administrative Area, Henan Province in central China.

Xinyang is the region mostly heavily inflicted by SFTSV, reporting 48% of SFTS cases in China [12]. The region has a humid subtropical climate with annual precipitation of around 1100 mm. The southern part of Xinyang, stretching across the Dabie Mountain range, is an important habitat for H. longicornis ticks in China [13]. Xinyang is also reported to be epidemic area of many tick-borne diseases such as human granulocytic anaplasmosis, spotted fever and typhus fever [14, 15]. These findings indicated that H. longicornis might be potential vector of causative agents. Therefore we expect the metagenomic analysis in this region might provide a broad list of the pathogens carried by this important vector, thereby offering the potential humans infection risk imposed by tick bites.

Methods

Ticks collection and DNA/RNA extraction

The questing ticks were captured from 10 sampling sites across Xinyang. Sample sites were selected from representative geographical areas where patients got tick bite in Dabie Mountain area and plain area. (Dabie Mountain area: 31.69 N, 115.45E; 31.59 N, 115.30E; 31.76 N, 115.27E; 31.70 N, 114.82E; 31.66 N, 115.01E; plain: 32.48 N, 115,31E; 32.40 N, 115.24E; 32.38 N, 115.45E; 32.25 N, 114.90E; 32.33 N, 115.11E), Henan Province, in May 2013. The ticks were collected by dragging over the vegetation layer during daytime. Morphologic features were used to identify the species and developmental stage of ticks by an entomologist (Sun Y) [16]. 10–15 H. longicornis from each site were randomly selected and totally 144 ticks were included in our study. The predominant tick species was confirmed to be H. longicornis. Live H. longicornis ticks were subsequently sterilised in 75% ethanol and then washed up with deionised water for 5 min each to remove environmental contaminants. DNA and RNA were extracted from single tick using TIANamp DNA/RNA extraction kit (Tiangen, Beijing, China) according to the manufacturer’s instructions.

Library preparation for high-throughput sequencing

The DNA/RNA extracted from 144 ticks were pooled respectively as the templates for library preparation. For prokaryotic pathogen screening, the pooled DNA was amplified in 50 μl reactions: 26.5 μl pure water, 10 μl 5 × phusion HF buffer (Thermo scientific, Hudson, NH, USA), 1 μl 10 mmol/L dNTPs (Thermo scientific), 2 μl of the 16S F and 16S R primers [17] (Invitrogen Corp., Carlsbad, CA), 0.5 μl Phusion High-Fidelity DNA polymerase (Thermo scientific), and 10 μl DNA(≈ 50 ng). The amplification was conducted according to a protocol involving initial denaturation for 30s at 98 °C and 35 cycles of 98 °C for 10 s, 55 °C for 30 s, 72 °C for 1 min, followed by a final extension at 72 °C for 7 min. Agarose gel with target fragments was purified using TIANgel Midi Purification Kit (Tiangen, Beijing, China) according to the manufacturer’s instruction. For eukaryotic pathogen screening, the pooled DNA was amplified as previously described using primers BTH-1F: cctgmgaracggctaccacatct and BTH-R: ttgcgaccatactccccca [18]. For virus screening, the pooled RNA was reverse transcripted with random hexmers to cDNA using Thermo Scientific Revert Aid First Strand cDNA Synthesis Kit (Thermo, Waltham, USA). The purified 16S and 18S PCR product, cDNA from RNA and DNA were sequenced with Ion Personal Genome Machine (PGM) System as described by Vogel and others [19]. Quality of the library was analysed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA).

Bioinformatics analysis

After sequencing, the individual sequence reads were filtered within the PGM software to remove low quality sequences. Sequences matching the PGM 3′adaptor were also automatically trimmed. Sequences that were shorter than 100 bp were deleted with an in-house python script. Each clean read was compared against the NCBI nucleotide collection (non-redundant nt database) using Blastn with default parameters (−v 5, −b 5, −w 35). The hit with the highest “Max Score” for every query was picked up, and the resulting hits were grouped by species according to its GI number. The number of reads and the total matched length of each species were calculated.

Specific PCR for detection of three pathogens in ticks

Based on the results from the alignments, specific PCR was performed to confirm the presence of pathogens in the DNA and RNA of individual ticks. The genes used for phylogenetic analysis were as below: 16S rDNA for Anaplasma spp., gltA gene for Rickettsia spp., 18S rDNA for Babesia spp. and the S segment for SFTSV. Total RNA from each sample (0.1–1 μg) was used for reverse transcription using the SuperScript III First-Strand Synthesis System (Invitrogen). DNA extracted from each sample and cDNA reverse-transcripted from each sample were used as PCR template.

The targeted genes were amplified from template in 30 μl PCR mixtures containing 120 mmol/L of each primer (Table 1) [2024], 60 mmol/L of each dNTP, 3 μl of 10 × rTaq PCR buffer (Takara, Dalian, China), and 1.5 U of rTaq DNA polymerase (Takara, Dalian, China). Amplification cycling conditions were as follows: denaturation for 3 min at 94 °C and 35 cycles of 94 °C for 45 s, 56 °C for 35 s, 72 °C for 1 min, followed by a final extension at 72 °C for 15 min. Amplified products were visualized with SYBR® Safe (Thermo, Waltham, USA) after electrophoresis in 2% agarose gel. For nested PCR, the second round were performed using the same reaction and cycling conditions as described above, and 1 μl of the first-round PCR production were used as template.
Table 1

Primers used in this study

Target

Gene

Primer

Primer name

Anaplasma

16S rRNA

Out1

TTGAGAGTTTGATCCTGGCTCAGAACG

Out2(21)

CACCTCTACACTAGGAATTCCGCTATC

Out2F

GATAGCGGAATTCCTAGTGTAGAGGTG

317Pan(20)

AAAGGAGGTAATCCAGC

Rickettsia

gltA

CS2d

ATGACCAATGAAAATAATAAT

CSEndr

CTTATACTCTCTATGTACA

RpCS877F

GGGGACCTGCTCACGGCGG

RpCS1258R(20)

ATTGCAAAAAGTACAGTGAACA

Coxiella

transposase

Cox_trans-3

GTAACGATGCGCAGGCGAT

Cox_trans-4(23)

CCACCGCTTCGCTCGCTA

Babesia

18S rDNA

Piro0F

GCCAGTAGTCATATGCTTGTGTTA

Piro1F

CCATGCATGTCTWAGTAYAARCTTTTA

Piro5.5R

CCTYTAAGTGATAAGGTTCACAAAACTT

Piro6R(22)

CTCCTTCCTYTAAGTGATAAGGTTCAC

SFTSV

S segment

BNYS1-F

TCTTCTCCATCAAGAACAGC

BNYS1-R(24)

TTCGACAAAATTAGACCTCC

The primers for amplification in this study are presented in Table 1. The PCR ampliconswere directly sequenced using an ABI 3730 machine (Applied Biosystems, Foster City, CA, USA). To reveal the evolutionary status of identified pathogens of interest, the phylogenetic analysis was performed using the Mega 5.0 software (http://www.megasoftware.net). The alignment was made under default parameters. Phylogenetic analysis was performed by the Maximum Likelihood method. All positions containing alignment gaps and missing data were deleted (complete-deletion).

Results

Taxonomic classification

The DNA and RNA extraction from a total of 144 adult H. longicornis ticks were respectively pooled into one sample, and subject to the high throughput sequencing. The fragments length of the constructed library ranged between 300 to 400 bp (Fig. 1). Totally 826 561 kb data were obtained, while 706 862 kb were of high quality (>Q20). A total of 6 926 470 reads were obtained with mean length of 233 bp (Fig. 2). The assignment of unassembled sequence reads to taxa based on BLASTN results revealed the existence of several pathogens, including Anaplasma spp., Rickettsia spp., Babesia spp., as well as SFTSV (Table 2).
Fig. 1
Fig. 1

The fragments’ distribution of sequencing library. Quality of the libraries were analysed using the Agilent 2100 Bioanalyzer. The fragments length of the constructed library mainly ranged between 300 and 400 bp

Fig. 2
Fig. 2

Run Report. Pseudo-colour image showing percent loading across the physical surface. This sequencing run had a 86% loading, which ensures a high ISP density. The number of total reads was up to 6 926 470 and 71% of the reads were usable. The median read length was 256 bp

Table 2

Potential pathogens presented by high-throughput sequencing

Species

Superkingdom

Total lengtha

Total numberb

Anaplasma bovis

Prokaryota

38 461

157

Anaplasma ovis

Prokaryota

21 710

85

Anaplasma phagocytophilum

Prokaryota

2123

12

Babesia bigemina

Eukaryota

2225

19

Babesia bovis

Eukaryota

1188

15

Babesia canis

Eukaryota

22 734

199

Babesia cf. divergens

Eukaryota

2808

20

Babesia divergens

Eukaryota

24 651

95

Babesia felis

Eukaryota

4036

16

Babesia gibsoni

Eukaryota

15 349

69

Babesia microti

Eukaryota

29 114

307

Babesia occultans

Eukaryota

31 359

233

Babesia odocoilei

Eukaryota

14 817

155

Babesia ovata

Eukaryota

4636

22

Babesia rossi

Eukaryota

2239

22

Babesia sp. 28

Eukaryota

8543

71

Babesia sp. 4 NAN-2012

Eukaryota

2 054 498

12 132

Babesia sp. giraffe 1505

Eukaryota

8671

37

Babesia sp. Kh-Hj143

Eukaryota

68 397

241

Babesia sp. MA#230

Eukaryota

58 780

236

Babesia sp. MA#361–2

Eukaryota

56 703

252

Babesia sp. NJ5

Eukaryota

3230

21

Babesia sp. NV-1

Eukaryota

4606

34

Babesia sp. RWF-2013

Eukaryota

15 721

80

Babesia sp. sable antelope/2005

Eukaryota

8071

33

Babesia sp. SAP#091

Eukaryota

497 797

1919

Babesia sp. SAP#131

Eukaryota

177 543

813

Babesia sp. UR1

Eukaryota

5355

34

Babesia sp. ‘venatorum’

Eukaryota

9688

59

Babesia sp. YZ-2012

Eukaryota

3 803 579

15 839

Coxiella burnetii

Prokaryota

3 480 573

13 807

Rickettsia australis

Prokaryota

25 868

93

Rickettsia conorii

Prokaryota

9580

45

Rickettsia heilongjiangensis

Prokaryota

628 174

2387

Rickettsia heilongjiangii

Prokaryota

42 045

189

Rickettsia japonica

Prokaryota

5718

23

Rickettsia prowazekii

Prokaryota

5166

26

Rickettsia rhipicephali

Prokaryota

3309

14

Rickettsia rickettsii

Prokaryota

376 004

1519

Rickettsia slovaca

Prokaryota

2357

16

Rickettsia sp. BJ-90

Prokaryota

9265

38

Rickettsia sp. MSeoKT1

Prokaryota

2799

18

Rickettsia sp. T170-B

Prokaryota

1 056 955

4112

Rickettsiella grylli

Prokaryota

15 798

91

Severe fever with thrombocytopenia syndrome virus

Viruses

1420

5

aTotal length: Sum of the reads that classified with the corresponding species

bTotal number: Number of reads that classified with the corresponding species

Confirmation of the pathogens and phylogenetic analysis

The remaining DNA/RNA from the 144 H. longicornis ticks were individually detected for the presence of these pathogens by PCR or RT-PCR (Additional file 2: Figure S1). The sequence analysis revealed the existence of Anaplasma bovis (Ehrlichia bovis, 13/144, 9.03%), Anaplasma centrale (2/144, 1.39%), Rickettsia heilongjiangensis (3/144, 2.08%), Rickettsia sp. LON-13 (1/144, 0.69%), Rickettsia raoultii (5/144, 3.47%), Babesia sp. (0.69%, 1/144) (Table 3). Three ticks were co-infected with SFTSV and A. bovis.
Table 3

Comparison of DNA sequence similarities between pathogens detected in ticks and the number of infection

Pathogen Genbank Match-Accession Number

Gene (Length)

Identity

Number of Infection (%)

Ehrlichia bovis-JN558824

16S (1490 bp)

99%

13 (9.03%)

Anaplasma centrale-AF283007

16S (1490 bp)

100%

2 (1.39%)

Rickettsia heilongjiangensis-EU665234

gltA (341 bp)

100%

3 (2.08%)

Rickettsia sp. LON-13-AB516964

gltA (341 bp)

100%

1 (0.69%)

Rickettsia raoultii

gltA (341 bp)

100%

5 (3.47%)

Babesia sp. MA#361–1-AB251610

18S (1619bp)

99%

1 (0.69%)

SFTSV-KC292288

S (491 bp)

100%

27 (18.75%)

Fig. 3
Fig. 3

Phylogenetic analysis of confirmed pathogens of interests. Sequences were aligned using the MEGA5 (Version5.1) software package. Phylogenetic analysis was performed by the Maximum Likelihood method. All positions containing alignment gaps and missing data were deleted (complete-deletion). Bars indicate the percentage of sequence divergence. All positions containing alignment gaps and missing data were deleted (Complete-deletion). a Phylogenetic tree of bacteria belonging to Anaplasma, inferred from comparison of the partial 16S rDNA gene sequences. b Phylogenetic tree of bacteria belonging to Rickettsia, inferred from comparison of the partial gltA gene sequences. c Phylogenetic tree of bacteria belonging to Babesia, inferred from comparison of the partial 18S rDNA gene sequences. d Phylogenetic tree of bacteria belonging to SFTSV, inferred from comparison of the partial S segment

By phylogenetic analysis, the Anaplasma spp. (KY007144-KY007156, KX817983, KX817984) identified in the H. longicornis ticks were shown to be clustered with A. centrale and A. bovis (Fig. 3a). Rickettsia, which is recognized as medically important arthropod-vectored pathogens, was found involved in symbiosis within 9 H. longicornis ticks, and clustered into three different branchs (KX817986-KX817988, KX965745- KX96575), R. heilongjiangensis, R. raoultii, and Rickettsia sp. LON-13 (Fig. 3b). One of the H. longicornis ticks was found carrying Babesia sp. (GenBank No. KX817985). The phylogenetic analysis showed the 18S rRNA gene was most close to Babesia sp. MA*361–1 (GenBank No.AB251610) and Babesia sp. SAP*091(GenBank No.AB251609) (Fig. 3c). The represented SFTSV sequences (KX817989, KX965742-KX965744) obtained from four H. longicornis ticks were clustered with sequences obtained from local SFTS patients [25] (Fig. 3d).

Discussion

In recent years, due to intense research interest in SFTS, there has been an increasing number of pathogens that were detected from H. longicornis ticks in SFTS endemic region [26]. Our study, based on the Next Generation Sequencing (NGS) methods, provided a broadened list of the microorganism harboured by this tick species, including prokaryotic and eukaryotic pathogens and viruses. In addition to SFTSV, other tick-borne pathogens, A. bovis (13/144, 9.03%), A. centrale (2/144, 1.39%), R. heilongjiangensis (3/144, 2.08%), R. raoultii (5/144, 3.47%), were detected as well.

Members of the genus Anaplasma include A. phagocytophilum, A.marginale, A. bovis, A. ovis, A. platys and A. centrale, all of which are obligate intracellular bacteria that infect a variety of cell types [27]. In China, wild and domestic ruminants play active roles as Anaplasma.sppcarriers and reservoirs. The presence of A. bovis in sheep and goats has been reported in Northwest, Central and Southern China [28, 29]. A. centrale has been reported in goats and sheep from South-eastern China [30]. Our results indicate the epidemic of A. bovis and A. centrale in central China. In the study, spotted fever group Rickettsia, including R. heilongjiangensis, R. raoultii and Rickettsia sp. LON-13 was detected in H. longicornis ticks in the same region. R. heilongjiangensis can cause spotted fever in humans, which was detected in Dermacentor. silvarum and H. longicornis ticks in Heilongjiang Province and Zhejiang Province [3133]. R. raoultii, the predominant Rickettsia found in Dermacentor silvarum ticks in China-Russia border areas [34], was also found in this area. According to phylogenetic analysis, Rickettsia sp. LON-13 was clustered in spotted fever group, and further investigation should be taken in livestock and human. Babesia sp. was detected in only one tick. According to phylogenetic analysis of 18S rRNA gene, Babesia from this tick was clustered between Babesia divergens and Babesia gibsoni, closing to Babesia sp. MA*361–1. This finding indicates the possible existence of a new Babesia species in local environment. Its prevalence in livestock and the risk to human beings requires to be investigated by an enhanced surveillance in the future.

Co-infection of A.bovis with SFTSV was identified, which is interesting while unexpected. Before the discovery of SFTSV, co-infection between Babesia microti (KJ715163) and Rickettsia sp. (KJ715194), Theileria luwenshuni (KJ715167) and Ehrlichia sp. (KJ715196), T. luwenshuni (KJ715168) and Anaplasma phagocytophilum (KJ715199) in H. longicornis ticks had been reported [26]. In addition, dual infection with A. phagocytophilum and B. microti in a Rattus norvegicus was found in this region [35]. However, the evidence of human dual infection was only recently reported from our previous research on the existence of CRT (Candidatus Rickettsia tarasevichiae) infection in clinical diagnosed SFTS patients [36]. Taken all of the findings together, we propose that in SFTS endemic areas bacterial infection including Anaplasma spp., Rickettsiae spp., Babesia spp., and co-infecitons of various tick-borne pathogens should be considered for patients after tick bite.

Since the discovery of SFTS in China, enormous efforts have been applied to identify SFTSV infection in both human being and the predominant tick species. However, other tick-borne pathogens were largely neglected. Due to nonspecific clinical presentation and less access to confirmatory laboratory findings, it is rather difficult to make diagnosis. In addition, novel Rickettsia and Babesia species of undetermined pathogenicity continue to be detected from ticks, highly possible to cause human illness. The current findings might have important application in determining the etiological determination in SFTS endemic region with H. longicornis as the predominant tick species, the most important tick-borne infectious disease not only in China, but also in countries where SFTSV infection has been reported.

Conclusions

In the study, a broadened list of the microorganism harboured by H. longicornis was provided. In SFTS region with abundant H. longicornis, prokaryotic infection including Anaplasma spp., Rickettsiae spp., and Babesia spp. should also be considered. The possibility of their co-infection with tick-borne viral pathogens in H. longicornis ticks, and dual infection in human, should be acknowledged by the clinicians. Specially, a novel Babesia species was identified in local natural foci, which needs further investigation in the future.

Abbreviations

SFTS: 

Severe fever with thrombocytopenia syndrome

SFTSV: 

Severe fever with thrombocytopenia syndrome virus

Declarations

Acknowledgements

We would like to thank all of the study participants for their commitment. We also specifically thank Mr. Hang Fan, Mr. Wei Wang, and other staff members at State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, for their efforts in data mining.

Funding

This study was funded by the Natural Science Foundation of China (81621005, 81472005, 81473023).

Availability of data and materials

The datasets collected and/or analysed during the current study are available from the corresponding author upon reasonable request. Please contact author for data requests.

Authors’ contributions

WL, ZCF and LZ conceived the study and led the writing of this article. LZ conducted the experiments, analysed the results, and wrote the manuscript. JD conducted the experiments and wrote the manuscript. XMC conducted the experiments. HL, FT, PHZ and JGH collected the ticks in the field. YGT led the data analysis. All authors reviewed and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, 20 Dong-Da Street, Fengtai District, Beijing, 100071, People’s Republic of China
(2)
Affiliated Bayi Children’s Hospital, PLA Army General Hospital, 5 Nan-Men-Cang, Dongcheng District, Beijing, 100700, People’s Republic of China
(3)
National Engineering Laboratory for Birth Defects Prevention and Control of Key Technology, 5 Nan-Men-Cang, Dongcheng District, Beijing, 100700, People’s Republic of China
(4)
Center for Diseases Control and Prevention of Chinese Peoples’ Armed Police Forces, Beijing, 102613, China

References

  1. Park SW, Song BG, Shin EH, Yun SM, Han MG, Park MY, et al. Prevalence of severe fever with thrombocytopenia syndrome virus in Haemaphysalis longicornis ticks in South Korea. Ticks Tick Borne Dis. 2014;5(6):975–7.View ArticlePubMedGoogle Scholar
  2. Tateno M, Sunahara A, Nakanishi N, Izawa M, Matsuo T, Setoguchi A, et al. Molecular survey of arthropod-borne pathogens in ticks obtained from Japanese wildcats. Ticks Tick Borne Dis. 2015;6(3):281–9.View ArticlePubMedGoogle Scholar
  3. Hammer JF, Emery D, Bogema DR, Jenkins C. Detection of Theileria orientalis genotypes in Haemaphysalis longicornis ticks from southern Australia. Parasit Vectors. 2015;8(1):229.View ArticlePubMedPubMed CentralGoogle Scholar
  4. Mediannikov O, Davoust B, Cabre O, Rolain JM, Raoult D. Bartonellae in animals and vectors in New Caledonia. Comp Immunol Microbiol Infect Dis. 2011;34(6):497–501.View ArticlePubMedGoogle Scholar
  5. Heath A. Biology, ecology and distribution of the tick, Haemaphysalis longicornis Neumann (Acari: Ixodidae) in New Zealand. N Z Vet J. 2015;7:1–32.Google Scholar
  6. Zhang YZ, Li J, Li JC, Hu XB, Liang DF, An DS. Preliminary investigation of ticks in Yigong, Tibet. Medical Journal of National Defending Forces in Southwest China. 2007;4:519–20. (in Chinese)Google Scholar
  7. Deng GF, Jiang ZJ. Economic insect fauna of China. Fasc 39. Acarina: Ixodidae. Beijing: Science Press; 1991. p. 181–5.Google Scholar
  8. Yu XJ, Liang MF, Zhang SY, Liu Y, Li JD, Sun YL, et al. Fever with thrombocytopenia associated with a novel bunyavirus in China. N Engl J Med. 2011;364(16):1523–32.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Takahashi T, Maeda K, Suzuki T, Ishido A, Shigeoka T, Tominaga T, et al. The first identification and retrospective study of severe fever with thrombocytopenia syndrome in Japan. J Infect Dis. 2014;209(6):816–27.View ArticlePubMedGoogle Scholar
  10. Yun SM, Lee WG, Ryou J, Yang SC, Park SW, Roh JY, et al. Severe fever with thrombocytopenia syndrome virus in ticks collected from humans, South Korea, 2013. Emerg Infect Dis. 2014;20(8):1358–61.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Luo LM, Zhao L, Wen HL, Zhang ZT, Liu JW, Fang LZ, et al. Haemaphysalis longicornis ticks as reservoir and vector of severe fever with thrombocytopenia syndrome virus in China. Emerg Infect Dis. 2015;21(10):1770–6.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Ding F, Zhang W, Wang L, Hu W, Soares Magalhaes RJ, sun H, et al. epidemiologic features of severe fever with thrombocytopenia syndrome in China, 2011-2012. Clin Infect Dis. 2013;56(11):1682–3.View ArticlePubMedGoogle Scholar
  13. Zhang YZ, Zhou DJ, Qin XC, Tian JH, Xiong Y, Wang JB, et al. The ecology, genetic diversity, and phylogeny of Huaiyangshan virus in China. J Virol. 2012;86(5):2864–8.View ArticlePubMedPubMed CentralGoogle Scholar
  14. Ge XC. Epidemic analysisi of human granulocytic anaplasmosis in Shihe, Xinyang. Chinese Journal of Public Health Management. 2012;28(3):304–5. (in Chinese)Google Scholar
  15. Zheng HJ. The investigation on scrub typhus group, Typhi group and Spored fever Group in Xinyang district of Henan. Zhengzhou University. 2013:23–4. (in Chinese)Google Scholar
  16. Yamaguti N, Tipton VJ, Keegan HL. S. T. Ticks of Japan, Korea and the Ryukyu islands. Brighan young university Sci Bull. 1971;15:1–226.View ArticleGoogle Scholar
  17. Zhuang L, Wang CY, Tong YG, Tang F, Yang H, Liu W, et al. Discovery of Rickettsia species in Dermacentor niveus Neumann ticks by investigating the diversity of bacterial communities. Ticks Tick Borne Dis. 2014;5(5):564–8.View ArticlePubMedGoogle Scholar
  18. Criado-Fornelio A, Martinez-Marcos A, Buling-Sarana A, Barba-Carretero JC. Molecular studies on Babesia, Theileria and Hepatozoon in southern Europe Part I. Vet Parasitol. 2003;113(3–4):189–201.View ArticlePubMedGoogle Scholar
  19. Vogel U, Szczepanowski R, Claus H, Junemann S, Prior K, Harmsen D. Ion torrent personal genome machine sequencing for genomic typing of Neisseria meningitidis for rapid determination of multiple layers of typing information. J Clin Microbiol. 2012;50(6):1889–94.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Li H, Jiang JF, Liu W, Zheng YC, Huo QB, Tang K, et al. Human infection with Candidatus Neoehrlichia mikurensis, China. Emerg Infect Dis. 2012;18(10):1636–9.View ArticlePubMedPubMed CentralGoogle Scholar
  21. Wen B, Jian R, Zhang Y, Chen R. Simultaneous detection of Anaplasma marginale and a new Ehrlichia species closely related to Ehrlichia chaffeensis by sequence analyses of 16S ribosomal DNA in Boophilus microplus ticks from Tibet. J Clin Microbiol. 2002;40(9):3286–90.View ArticlePubMedPubMed CentralGoogle Scholar
  22. Kawabuchi T, Tsuji M, Sado A, Matoba Y, Asakawa M, Ishihara C. Babesia microti-like parasites detected in feral raccoons (Procyon lotor) captured in Hokkaido, Japan. J Vet Med Sci. 2005;67(8):825–7.View ArticlePubMedGoogle Scholar
  23. Das DP, Malik SV, Rawool DB, Das S, Shoukat S, Gandham RK, et al. Isolation of Coxiella burnetii from bovines with history of reproductive disorders in India and phylogenetic inference based on the partial sequencing of IS1111 element. Infect Genet Evol. 2014;22:67–71.View ArticlePubMedGoogle Scholar
  24. Zhang YZ, He YW, Dai YA, Xiong Y, Zheng H, Zhou DJ, et al. Hemorrhagic fever caused by a novel Bunyavirus in China: pathogenesis and correlates of fatal outcome. Clin Infect Dis. 2012;54(4):527–33.View ArticlePubMedGoogle Scholar
  25. Liu W, Lu QB, Cui N, Li H, Wang LY, Liu K, et al. Case-fatality ratio and effectiveness of ribavirin therapy among hospitalized patients in China who had severe fever with thrombocytopenia syndrome. Clin Infect Dis. 2013;57(9):1292–9.View ArticlePubMedGoogle Scholar
  26. Chen Z, Liu Q, Liu JQ, Xu BL, Lv S, Xia S, et al. Tick-borne pathogens and associated co-infections in ticks collected from domestic animals in Central China. Parasit Vectors. 2014;7:237.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH, Ray SC, et al. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol. 2001;51(6):2145–65.View ArticlePubMedGoogle Scholar
  28. Liu Z, Ma M, Wang Z, Wang J, Peng Y, Li Y, et al. Molecular survey and genetic identification of Anaplasma species in goats from central and southern China. Appl Environ Microbiol. 2012;78(2):464–70.View ArticlePubMedPubMed CentralGoogle Scholar
  29. Yang J, Li Y, Liu Z, Liu J, Niu Q, Ren Q, et al. Molecular detection and characterization of Anaplasma spp. in sheep and cattle from Xinjiang, Northwest China. Parasit Vectors. 2015;8:108.View ArticlePubMedPubMed CentralGoogle Scholar
  30. Ge Y, Yin H, Rikihisa Y, Pan W, Yin H. Molecular detection of tick-borne rickettsiales in goats and sheep from southeastern China. Vector Borne Zoonotic Dis. 2016;16(5):309–16.View ArticlePubMedGoogle Scholar
  31. Fournier PE, Dumler JS, Greub G, Zhang J, Wu Y, Raoult D. Gene sequence-based criteria for identification of new rickettsia isolates and description of Rickettsia heilongjiangensis sp. nov. J Clin Microbiol. 2003;41(12):5456–65.View ArticlePubMedPubMed CentralGoogle Scholar
  32. Jiao Y, Wen B, Chen M, Niu D, Zhang J, Qiu L. Analysis of immunoprotectivity of the recombinant OmpA of Rickettsia heilongjiangensis. Ann N Y Acad Sci. 2005;1063:261–5.View ArticlePubMedGoogle Scholar
  33. Sun J, Lin J, Gong Z, Chang Y, Ye X, Gu S, et al. Detection of spotted fever group Rickettsiae in ticks from Zhejiang Province, China. Exp Appl Acarol. 2015;65(3):403–11.View ArticlePubMedPubMed CentralGoogle Scholar
  34. Wen J, Jiao D, Wang JH, Yao DH, Liu ZX, Zhao G, et al. Rickettsia raoultii, the predominant Rickettsia found in Dermacentor silvarum ticks in China-Russia border areas. Exp Appl Acarol. 2014;63(4):579–85.View ArticlePubMedGoogle Scholar
  35. Zhao XG, Li H, Sun Y, Zhang YY, Jiang JF, Liu W, et al. Dual infection with Anaplasma phagocytophilum and Babesia microti in a Rattus norvegicus, China. Ticks Tick Borne Dis. 2013;4(5):399–402.View ArticlePubMedGoogle Scholar
  36. Liu W, Li H, Lu QB, Cui N, Yang ZD, Hu JG, et al. Candidatus rickettsia tarasevichiae infection in eastern Central China: a case series. Ann Intern Med. 2016;164(10):641–8.View ArticlePubMedGoogle Scholar

Copyright

Advertisement